e g the 454 gs flx and or gs junior sequencing systems (Roche)
Roche manufactures this product 
86
Structured Review
Roche
e g the 454 gs flx and or gs junior sequencing systems
E G The 454 Gs Flx And Or Gs Junior Sequencing Systems, supplied by Roche, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/454+gs+junior+system/us12049490-260-71-70
Average 86 stars, based on 1 article reviews
E G The 454 Gs Flx And Or Gs Junior Sequencing Systems, supplied by Roche, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/454+gs+junior+system/us12049490-260-71-70
Average 86 stars, based on 1 article reviews
e g the 454 gs flx and or gs junior sequencing systems - by Bioz Stars,
2026-09
86/100 stars
Images
Related Articles
Polymerase Chain Reaction:Article Title: Preferential Usage of Specific Immunoglobulin Heavy Chain Variable Region Genes With Unmutated Profile and Advanced Stage at Presentation Are Common Features in Patients With Chronic Lymphocytic Leukemia From Senegal. Article Snippet: In total, 1 μg total extracted RNA per case was transcribed into complementary DNA using the QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. .. Resulting cDNA was subjected to polymerase chain reaction amplification of the IGVH locus by using modified BIOMED-2 framework region 1 consensus primers in conjunction with a consensus J segment primer, as previously described.27 Data analysis was performed using the Roche (Basel, Switzerland) proprietary software package for the Amplification:Article Title: Preferential Usage of Specific Immunoglobulin Heavy Chain Variable Region Genes With Unmutated Profile and Advanced Stage at Presentation Are Common Features in Patients With Chronic Lymphocytic Leukemia From Senegal. Article Snippet: In total, 1 μg total extracted RNA per case was transcribed into complementary DNA using the QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. .. Resulting cDNA was subjected to polymerase chain reaction amplification of the IGVH locus by using modified BIOMED-2 framework region 1 consensus primers in conjunction with a consensus J segment primer, as previously described.27 Data analysis was performed using the Roche (Basel, Switzerland) proprietary software package for the Article Title: Lake Erie ice is a repository of organisms. Article Snippet: For pyrosequencing, 454-specific primers, one with 454 sequence A (underlined): CGTAT CGCCTCCCTCGCGCCATCAGAATTCGCGGCCGCGTCGAC and the other with 454 sequence B (underlined): CTATGCGCCTTGCCAGCCCGCTCAGAATTCGCGGCCGCGTCGAC, were added to the nucleic acids using PCR (4 min at 94°C, followed by 40 cycles of 1 min at 94°C, 2 min at 55°C, 72°C, followed by 10 min at 72°C). .. The amplified nucleic acids were quantified on agarose gels and subjected to sequencing using a Article Title: Lake Erie ice is a repository of organisms Article Snippet: For pyrosequencing, 454-specific primers, one with 454 sequence A (underlined): CGTATCGCCTCCCTCGCGCCA TCAGAATTCGCGGCCGCGTCGAC and the other with 454 sequence B (underlined): CTATGCGCCTTGCCAGCCCGC TCAGAATTCGCGGCCGCGTCGAC , were added to the nucleic acids using PCR (4 min at 94°C, followed by 40 cycles of 1 min at 94°C, 2 min at 55°C, 72°C, followed by 10 min at 72°C). .. The amplified nucleic acids were quantified on agarose gels and subjected to sequencing using a Modification:Article Title: Preferential Usage of Specific Immunoglobulin Heavy Chain Variable Region Genes With Unmutated Profile and Advanced Stage at Presentation Are Common Features in Patients With Chronic Lymphocytic Leukemia From Senegal. Article Snippet: In total, 1 μg total extracted RNA per case was transcribed into complementary DNA using the QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. .. Resulting cDNA was subjected to polymerase chain reaction amplification of the IGVH locus by using modified BIOMED-2 framework region 1 consensus primers in conjunction with a consensus J segment primer, as previously described.27 Data analysis was performed using the Roche (Basel, Switzerland) proprietary software package for the Software:Article Title: Preferential Usage of Specific Immunoglobulin Heavy Chain Variable Region Genes With Unmutated Profile and Advanced Stage at Presentation Are Common Features in Patients With Chronic Lymphocytic Leukemia From Senegal. Article Snippet: In total, 1 μg total extracted RNA per case was transcribed into complementary DNA using the QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. .. Resulting cDNA was subjected to polymerase chain reaction amplification of the IGVH locus by using modified BIOMED-2 framework region 1 consensus primers in conjunction with a consensus J segment primer, as previously described.27 Data analysis was performed using the Roche (Basel, Switzerland) proprietary software package for the Sequencing:Article Title: RNA and DNA Sanger sequencing versus next-generation sequencing for HIV-1 drug resistance testing in treatment-naive patients. Article Snippet: Amplicons were added to DNA capture beads at a ratio of two molecules per capture bead, and emulsion PCR was performed using the Lib-A emPCR kit (Roche). .. Then, DNA library bead enrichment was carried out and a 200 cycle sequencing was run on the Roche Article Title: Lake Erie ice is a repository of organisms. Article Snippet: For pyrosequencing, 454-specific primers, one with 454 sequence A (underlined): CGTAT CGCCTCCCTCGCGCCATCAGAATTCGCGGCCGCGTCGAC and the other with 454 sequence B (underlined): CTATGCGCCTTGCCAGCCCGCTCAGAATTCGCGGCCGCGTCGAC, were added to the nucleic acids using PCR (4 min at 94°C, followed by 40 cycles of 1 min at 94°C, 2 min at 55°C, 72°C, followed by 10 min at 72°C). .. The amplified nucleic acids were quantified on agarose gels and subjected to sequencing using a Article Title: Lake Erie ice is a repository of organisms Article Snippet: For pyrosequencing, 454-specific primers, one with 454 sequence A (underlined): CGTATCGCCTCCCTCGCGCCA TCAGAATTCGCGGCCGCGTCGAC and the other with 454 sequence B (underlined): CTATGCGCCTTGCCAGCCCGC TCAGAATTCGCGGCCGCGTCGAC , were added to the nucleic acids using PCR (4 min at 94°C, followed by 40 cycles of 1 min at 94°C, 2 min at 55°C, 72°C, followed by 10 min at 72°C). .. The amplified nucleic acids were quantified on agarose gels and subjected to sequencing using a Next-Generation Sequencing:Article Title: Assessing the potential of next generation sequencing technologies for missing persons identification efforts Article Snippet: To assess the utility of next generation sequencing (NGS) technologies for missing persons applications, we have recently initiated a study of various platforms and target enrichment strategies for sample types regularly encountered in our large-scale identification efforts.. Specific laboratory workflows based on target marker enrichment and NGS platform are being considered for different sample types, and the overall effort is being undertaken with a strong emphasis on both raw data and final consensus sequence quality.. The current study is first and foremost a general evaluation of these data and technologies from the standpoint of forensic application, yet the strategy we are pursuing is ultimately intended to facilitate NGS integration into standard casework laboratories. Generated:Article Title: Assessing the potential of next generation sequencing technologies for missing persons identification efforts Article Snippet: To assess the utility of next generation sequencing (NGS) technologies for missing persons applications, we have recently initiated a study of various platforms and target enrichment strategies for sample types regularly encountered in our large-scale identification efforts.. Specific laboratory workflows based on target marker enrichment and NGS platform are being considered for different sample types, and the overall effort is being undertaken with a strong emphasis on both raw data and final consensus sequence quality.. The current study is first and foremost a general evaluation of these data and technologies from the standpoint of forensic application, yet the strategy we are pursuing is ultimately intended to facilitate NGS integration into standard casework laboratories. |
